ID 21-T161
Registered: 2007.03.13 Last update: 2018.05.31
| Gene Name | ENAH actin regulator | Gene Symbol | Enah | |||
| Chromosome | 1 | Genomic Location | chr1:183,830,000-183,960,000 |  |
||
| Synonyms | Mena, WBP8, Ndpp1, NDPP-1 | |||||
| Links |
UCSC Genome Browser(chr1:183,830,000-183,960,000) NCBI Gene(13800) IGTC(Enah,2776) UNIGene(Mm.389224) |
MGI(108360) KEGG GENES(mmu:13800) EST Profile(mm.389224) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T192, 21-T453 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB297891 | GSS Location | chr1:183,949,661-183,949,734 | Size | 74 |
| Sequence | TCCCCGCCTGAGAAGAGACCCTCCGCTCGGCGGCTCCCGCGCCGGGGTAGCCTCGGCGCCGCCGG CACCATGAG |
||||
| Links |
UCSC Browser(chr1:183,949,661-183,949,734) IGTC(Ayu21-T161) |
||||
Homology Search Results
| [MMU72520] Mus musculus mena protein (Mena) mRNA, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Enah) |
||||