ID 21-T168
Registered: 2007.01.29 Last update: 2018.06.01
| Gene Name | insulin degrading enzyme | Gene Symbol | Ide | |||
| Chromosome | 19 | Genomic Location | chr19:37,340,000-37,418,000 |  |
||
| Synonyms | AA675336, AI507533, 1300012G03Rik, 4833415K22Rik | |||||
| Links |
UCSC Genome Browser(chr19:37,340,000-37,418,000) NCBI Gene(15925) IGTC(Ide,9637) UNIGene(Mm.28366) |
MGI(96412) KEGG GENES(mmu:15925) EST Profile(mm.28366) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB291808 | GSS Location | Size | 98 | |
| Sequence | ATGCGGAACGGGCTCGTGTGGCTGCTGCACCCCGCGCTGCCCGGCACCTTGCGCTCCATCCTCGG CGCCCGCCCGCCGCCCGCGAAGCGACTGTGTGG |
||||
| Links |
UCSC Browser() IGTC(Ayu21-T168) |
||||
Homology Search Results
| [AJ278422] Mus musculus mRNA for insulin degrading enzyme (Ide gene). |
Mouse Information
| Card ID | 1034 | ||||
| Strain Name | B6;CB-IdeGt(pU-21T)168Imeg | ||||
| Internal Code | Ayu21-T168 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ide) |
||||