ID 21-T17
Registered: 2006.07.10 Last update: 2018.06.01
| Gene Name | tousled-like kinase 2 (Arabidopsis) | Gene Symbol | Tlk2 | |||
| Chromosome | 11 | Genomic Location | chr11:105,037,000-105,148,000 |  |
||
| Synonyms | 4933403M19Rik, PKUalpha, protein kinase U-alpha, Tlk, PKU-alpha | |||||
| Links |
UCSC Genome Browser(chr11:105,037,000-105,148,000) NCBI Gene(24086) IGTC(Tlk2,12585) UNIGene(Mm.126976) |
MGI(1346023) KEGG GENES(mmu:24086) EST Profile(mm.126976) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB265251 | GSS Location | chr11:105,043,328-105,045,608 | Size | 121 |
| Sequence | CCCCTCCCGAGAGGAGGGTGGAGCGGCAGCGGCGGCAGAAATGATGGAAGAACTGCATAGCCTGG ACCCACGAAGGCAGGAATTACTAGAGGCCAGGTTCACTGGAGTTGGTGTAAGTAAG |
||||
| Links |
UCSC Browser(chr11:105,043,328-105,045,608) IGTC(Ayu21-T17) |
||||
Homology Search Results
| [AK165667] Mus musculus cDNA, RIKEN full-length enriched library, clone:G430124E20 product:tousled-like kinase 2 (Arabidopsis), full insert sequence. |
Mouse Information
| Card ID | 971 | ||||
| Strain Name | B6;CB-Tlk2Gt(pU-21T)17Imeg | ||||
| Internal Code | Ayu21-T17 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tlk2) |
||||