ID 21-T172
Registered: 2007.02.03 Last update: 2018.06.01
| Gene Name | DEP domain containing MTOR-interacting protein | Gene Symbol | Deptor | |||
| Chromosome | 15 | Genomic Location | chr15:54,940,000-55,090,000 |  |
||
| Synonyms | 4731402B04Rik, 9130412E02Rik, D15Ertd336e, D15Ertd597e, Depdc6 | |||||
| Links |
UCSC Genome Browser(chr15:54,940,000-55,090,000) NCBI Gene(97998) IGTC(Deptor,11788) UNIGene(Mm.295397) |
MGI(2146322) KEGG GENES(mmu:97998) EST Profile(mm.295397) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB292611 | GSS Location | chr15:54,943,939-54,944,174 | Size | 236 |
| Sequence | GCACCGCCCGGAACAAAGATGGCCGGGGCGGCCTCGGGGAGGGCACATTGATCCAAACGCCAGGC GCACCCGCCGGGACAGCAAAGGCAGAGTGGCAACCGCGCGGTCAGGAACATGGAAGAGGGCAGCA GCGGCGGCAGTGGTAGCAGCGACAGCAACGCCGGCGGGAGCGGCGGGGTGCAGCAGAGAGAGCTG GAACGCATGGCTGAAGTCCTAGTTACGGGAGAGCAGCTCCG |
||||
| Links |
UCSC Browser(chr15:54,943,939-54,944,174) IGTC(Ayu21-T172) |
||||
Homology Search Results
| [BC004774] us musculus cDNA clone IMAGE:3257322, containing frame-shift errors. |
Mouse Information
| Card ID | 1044 | ||||
| Strain Name | B6;CB-DeptorGt(pU-21T)172Imeg | ||||
| Internal Code | Ayu21-T172 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Deptor) |
||||