ID 21-T175
Registered: 2007.02.03 Last update: 2018.06.01
| Gene Name | pseudouridine synthase 1 | Gene Symbol | Pus1 | |||
| Chromosome | 5 | Genomic Location | chr5:111,202,500-111,210,000 |  |
||
| Synonyms | A730013B20Rik, MPUS1, mPus1p | |||||
| Links |
UCSC Genome Browser(chr5:111,202,500-111,210,000) NCBI Gene(56361) IGTC(Pus1,2772) UNIGene(Mm.23528) |
MGI(1929237) KEGG GENES(mmu:56361) EST Profile(mm.23528) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB292612 | GSS Location | chr5:111,208,706-111,208,916 | Size | 211 |
| Sequence | CCTGCCGCCTATGGCTGGAAACAAGGTGCCACCAGCGCTGGCCTCACACCAACCGGACAGGAAGG GCCGAGGTGGCTGGGTNTGGGAGGAGACGGAGCATCCTGCAAAGAGGGTCAAGGGCGGCGAGGAT GAAGAGCCCCCACGCAAGCTGCCAAAGCGAAAAATTGTGCTGCTCATGGCCTACTCGGGCAAGGG CTACCACGGCATGCAG |
||||
| Links |
UCSC Browser(chr5:111,208,706-111,208,916) IGTC(Ayu21-T175) |
||||
Homology Search Results
| [AB041563] Mus musculus brain cDNA, clone MNCb-0873, similar to Mus musculus pseudouridine synthase 1 (Pus1) mRNA. |
Mouse Information
| Card ID | 1038 | ||||
| Strain Name | B6;CB-Pus1Gt(pU-21T)175Imeg | ||||
| Internal Code | Ayu21-T175 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Pus1) |
||||