ID 21-T178
Registered: 2007.02.03 Last update: 2018.06.01
| Gene Name | serine/arginine-rich protein specific kinase 2 | Gene Symbol | Srpk2 | |||
| Chromosome | 5 | Genomic Location | chr5:23,006,000-23,190,000 |  |
||
| Synonyms | Wbp6; mSRPK2; AW226533; AW492537; AW547358 | |||||
| Links |
UCSC Genome Browser(chr5:23,006,000-23,190,000) NCBI Gene(20817) IGTC(Srpk2,2495) UNIGene(Mm.288728) |
MGI(1201408) KEGG GENES(mmu:20817) EST Profile(mm.288728) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB292614 | GSS Location | chr5:23,122,145-23,181,695 | Size | 139 |
| Sequence | CGGAATGAGCTCCAGGAAAGTGCTGGCCATTCAGGCCCGAAAGCGGAGGCCGAAAAGAGAGAAAC ATCCGAAAAAAAATCAAGCAGAAGACTGAGCTGCTGATGTCAGTTAACTCTGAGAAGTCGTCCTC TTCAGAAAG |
||||
| Links |
UCSC Browser(chr5:23,122,145-23,181,695) IGTC(Ayu21-T178) |
||||
Homology Search Results
| [BY718450] BY718450 RIKEN full-length enriched, adult male medulla oblongata Mus musculus cDNA clone 6330510I06 5', mRNA sequence. |
Mouse Information
| Card ID | 1211 | ||||
| Strain Name | B6;CB-Srpk2Gt(pU-21T)178Imeg | ||||
| Internal Code | Ayu21-T178 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Srpk2) |
||||