ID 21-T180
Registered: 2007.02.03 Last update: 2018.06.01
| Gene Name | transmembrane protein 248 | Gene Symbol | Tmem248 | |||
| Chromosome | 5 | Genomic Location | chr5:130,695,000-130,720,000 |  |
||
| Synonyms | AW557951; 0610007L01Rik; A930023A16Rik; G430067H08Rik | |||||
| Links |
UCSC Genome Browser(chr5:130,695,000-130,720,000) NCBI Gene(71667) IGTC(Tmem248,8) UNIGene(Mm.258508) |
MGI(1918917) KEGG GENES(mmu:71667) EST Profile(mm.258508) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB292615 | GSS Location | chr5:130,698,219-130,698,442 | Size | 224 |
| Sequence | CCTTCACCCGGAAAGCCCGGCGTTCGCAGCGCGCGGAGCCGGCGTCCCGTTGGCGCGCTCTGGCC TGGCTTCGGGTCGTCGCTTCGGCCCCGAGGAGCCGCTCGCTGTCTCCGGAGCGGCGGAGAGGATG GTGCGGGGCAGCCCGGGGCCCGCCGCGCTCCGCCGCGAGTGAACAGGGCCAGGCCGCGGGCGTCC GCGGGCTCGAGCCGCCAGTCTGCGGGGCG |
||||
| Links |
UCSC Browser(chr5:130,698,219-130,698,442) IGTC(Ayu21-T180) |
||||
Homology Search Results
| [AK142176] Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330005J15 product:hypothetical protein, full insert sequence. |
Mouse Information
| Card ID | 1035 | ||||
| Strain Name | B6;CB-Tmem248Gt(pU-21T)180Imeg | ||||
| Internal Code | Ayu21-T180 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tmem248) |
||||