| Gene Name | eukaryotic translation elongation factor 1 gamma | Gene Symbol | Eef1g | |||
| Chromosome | 19 | Genomic Location | chr19:9,041,300-9,053,000 | |||
| Synonyms | 2610301D06Rik, EF1G, AA407312 | |||||
| Links |
UCSC Genome Browser(chr19:9,041,300-9,053,000) NCBI Gene(67160) IGTC(Eef1g,10446) UNIGene(Mm.379129) |
MGI(1914410) KEGG GENES(mmu:67160) EST Profile(mm.379129) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB265214 | GSS Location | chr19:9,047,465-9,047,598 | Size | 134 |
| Sequence | CAGAAACCCCAGGCTGAGCGGAAGGAGGAAAAAAAGGCAGCTGCCCCAGCTCCTGAGGAAGAGAT GGATGAGTGTGAGCAGGCATTGGCTGCTGAGCCCAAGGCCAAGGACCCTTTCGCTCACCTGCCCA AGAG |
||||
| Links |
UCSC Browser(chr19:9,047,465-9,047,598) IGTC(Ayu21-T19) |
||||
| [BC099413] Mus musculus eukaryotic translation elongation factor 1 gamma, mRNA (cDNA clone MGC:117581 IMAGE:30839877), complete cds. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Eef1g) |
||||