Gene Name | lysophospholipase 2 | Gene Symbol | Lypla2 | |||
Chromosome | 4 | Genomic Location | chr4:135,524,000-135,528,600 | ![]() |
||
Synonyms | lysophospholipase II, LysoII | |||||
Links |
UCSC Genome Browser(chr4:135,524,000-135,528,600) NCBI Gene(26394) IGTC(Lypla2,21047) UNIGene(Mm.34302) |
MGI(1347000) KEGG GENES(mmu:26394) EST Profile(mm.34302) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB292814 | GSS Location | chr4:135,528,433-135,528,482 | Size | 50 |
Sequence | GGAGAAAGGGGAGAATCGCCCGAACGGTCTCGGAAGCCACTGGGAGTGAG | ||||
Links |
UCSC Browser(chr4:135,528,433-135,528,482) IGTC(Ayu21-T190) |
[AB009653] Mus musculus mRNA for lysophospholipase II, complete cds. |
Card ID | 1210 | ||||
Strain Name | B6;CB-Lypla2Gt(pU-21T)190Imeg | ||||
Internal Code | Ayu21-T190 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Lypla2) |