ID 21-T190
Registered: 2007.02.10 Last update: 2018.06.01
| Gene Name | lysophospholipase 2 | Gene Symbol | Lypla2 | |||
| Chromosome | 4 | Genomic Location | chr4:135,524,000-135,528,600 |  |
||
| Synonyms | lysophospholipase II, LysoII | |||||
| Links |
UCSC Genome Browser(chr4:135,524,000-135,528,600) NCBI Gene(26394) IGTC(Lypla2,21047) UNIGene(Mm.34302) |
MGI(1347000) KEGG GENES(mmu:26394) EST Profile(mm.34302) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB292814 | GSS Location | chr4:135,528,433-135,528,482 | Size | 50 |
| Sequence | GGAGAAAGGGGAGAATCGCCCGAACGGTCTCGGAAGCCACTGGGAGTGAG | ||||
| Links |
UCSC Browser(chr4:135,528,433-135,528,482) IGTC(Ayu21-T190) |
||||
Homology Search Results
| [AB009653] Mus musculus mRNA for lysophospholipase II, complete cds. |
Mouse Information
| Card ID | 1210 | ||||
| Strain Name | B6;CB-Lypla2Gt(pU-21T)190Imeg | ||||
| Internal Code | Ayu21-T190 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Lypla2) |
||||