ID 21-T191
Registered: 2007.02.10 Last update: 2018.06.01
| Gene Name | solute carrier family 38, member 1 | Gene Symbol | Slc38a1 | |||
| Chromosome | 15 | Genomic Location | chr15:96,400,000-96,475,000 |  |
||
| Synonyms | NAT2; AA408026; AA409865; AL022800; AU015942 | |||||
| Links |
UCSC Genome Browser(chr15:96,400,000-96,475,000) NCBI Gene(105727) IGTC(Slc38a1,5294) UNIGene(Mm.103568) |
MGI(2145895) KEGG GENES(mmu:105727) EST Profile(mm.103568) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB292815 | GSS Location | chr15:96,472,559-96,472,747 | Size | 189 |
| Sequence | TGAAGGTCGCCGGTAACCCGGCCTTTTACCTTCCTCCGAAACCCGCCACGCGGATCCTCCCCGCC CAGTCTTACAGACCTGGGGCCACCTTTCCCTAGCTAGTCCTTGACACAAAAAAGGACATCTAACT GCCGGGGACGGCCTGGAAGGGCGGACACTTTGGTGGCGCCTTTCCCTTTATTTCTCGAG |
||||
| Links |
UCSC Browser(chr15:96,472,559-96,472,747) IGTC(Ayu21-T191) |
||||
Homology Search Results
| [BB865464] BB865464 RIKEN full-length enriched, pooled cell lines, RCB-0544,etc. Mus musculus cDNA clone G431001J05 5', mRNA sequence. |
Mouse Information
| Card ID | 1595 | ||||
| Strain Name | B6;CB-Slc38a1Gt(pU-21T)191Card | ||||
| Internal Code | Ayu21-T191 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Slc38a1) |
||||