ID 21-T218
Registered: 2007.06.29 Last update: 2018.06.01
| Gene Name | MAP/microtubule affinity-regulating kinase 2 | Gene Symbol | Mark2 | |||
| Chromosome | 19 | Genomic Location | chr19:7,349,500-7,420,000 |  |
||
| Synonyms | Emk, EMK-1, Par-1, Par-1b | |||||
| Links |
UCSC Genome Browser(chr19:7,349,500-7,420,000) NCBI Gene(13728) IGTC(Mark2,9043) UNIGene(Mm.258986) |
MGI(99638) KEGG GENES(mmu:13728) EST Profile(mm.258986) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330872 | GSS Location | chr19:7,416,257-7,416,344 | Size | 89 |
| Sequence | GGTGGCTGCTGGTTGGCTCTGGAGGTGCGGGGAGTCTCTTCGTGGATTTCCGTAAACAGAGCCGA ACCTCGGTCTTCGGAATCTAGGAG |
||||
| Links |
UCSC Browser(chr19:7,416,257-7,416,344) IGTC(Ayu21-T218) |
||||
Homology Search Results
| [BB849884] LOCUS: BB849884, dbEST Id: 10366642, EST name: BB849884, GenBank Acc: BB849884, GenBank gi: 17091338 |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Mark2) |
||||