ID 21-T221
Registered: 2007.08.18 Last update: 2018.06.01
| Gene Name | ring finger protein 2 | Gene Symbol | Rnf2 | |||
| Chromosome | 1 | Genomic Location | chr1:153,315,000-153,350,000 |  |
||
| Synonyms | dinG, Ring1B, AI326319, AI450156, AU019207 | |||||
| Links |
UCSC Genome Browser(chr1:153,315,000-153,350,000) NCBI Gene(19821) IGTC(Rnf2,5288) UNIGene(Mm.290905) |
MGI(1101759) KEGG GENES(mmu:19821) EST Profile(mm.290905) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB355650 | GSS Location | chr1:153,347,849-153,347,939 | Size | 91 |
| Sequence | GACTCGCCATATTGTGCGGCGGCGCCGGCGGTTGATTCTCGAGTCTCGCTCCGGCCACTGCCAGC GCACCCCCGGGCTGGGGCAGGAGCCG |
||||
| Links |
UCSC Browser(chr1:153,347,849-153,347,939) IGTC(Ayu21-T221) |
||||
Homology Search Results
| [AK030319] Mus musculus 11 days pregnant adult female ovary and uterus cDNA, RIKEN full-length enriched library, clone:5031429P04 product:ring finger protein 2, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rnf2) |
||||