ID 21-T226

Registered: 2007.06.13   Last update: 2018.06.01
Gene Name ralA binding protein 1 Gene Symbol Ralbp1
Chromosome 17 Genomic Location chr17:66,196,589-66,236,065
Synonyms RLIP76, Rip1
Links UCSC Genome Browser(chr17:66,196,589-66,236,065)
NCBI Gene(19765)
IGTC(Ralbp1,8002)
UNIGene(Mm.17009)
 MGI(108466)
KEGG GENES(mmu:19765)
EST Profile(mm.17009)
Other Clone Trapped This Gene
Trap Vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB325682 GSS Location chr17:66,234,526-66,234,647 Size 122
Sequence TGGGGGGAAAAGTGTCACTCTCAGTAGCTGCGGACACCAGGCCAGAGCTTGGGGAGGAACGCGCT
TTCTTTCCAGCAGAGCTCCGCAGGGCTCCCACACTGTTTTCACTTGGATTCGCTCCG
Links UCSC Browser(chr17:66,234,526-66,234,647)
IGTC(Ayu21-T226)

Homology Search Results

[AK133613] Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330415G10 product:ralA binding protein 1, full insert sequence.
[AK136116] Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length enriched library, clone:7420458L04 product:ralA binding protein 1, full insert sequence.

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for Ralbp1)