ID 21-T229
Registered: 2007.07.15 Last update: 2018.06.01
| Gene Name | melanoregulin | Gene Symbol | Mreg | |||
| Chromosome | 1 | Genomic Location | chr1:72,205,000-72,260,000 |  |
||
| Synonyms | Wdt2, LOC381269, dsu, Gm974 | |||||
| Links |
UCSC Genome Browser(chr1:72,205,000-72,260,000) NCBI Gene(381269) IGTC(Mreg,1596) UNIGene(Mm.422636) |
MGI(2151839) KEGG GENES(mmu:381269) EST Profile(mm.422636) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332409 | GSS Location | chr1:72,258,591-72,258,695 | Size | 105 |
| Sequence | CTCGCTCCCCATGGGGCTGCGCCGCTGGCTACGGAGCGCCTGCTGCTGCTGCCCGTGCCGGTGCC TGGAGGAGCCCGCGCGGCCCGAGAAGGAGCCGCTGGTCAG |
||||
| Links |
UCSC Browser(chr1:72,258,591-72,258,695) IGTC(Ayu21-T229) |
||||
Homology Search Results
| [BC068125] Mus musculus melanoregulin, mRNA (cDNA clone MGC:92980 IMAGE:6828150), complete cds. |
Mouse Information
| Card ID | 1107 | ||||
| Strain Name | B6;CB-MregGt(pU-21T)229Imeg | ||||
| Internal Code | Ayu21-T229 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Mreg) |
||||