Gene Name | replication protein A1 | Gene Symbol | Rpa1 | |||
Chromosome | 11 | Genomic Location | chr11:75,112,000-75,165,000 | |||
Synonyms | Rpa, RF-A, RP-A, 70kDa, AA589576, AW557552, 5031405K23Rik | |||||
Links |
UCSC Genome Browser(chr11:75,112,000-75,165,000) NCBI Gene(68275) IGTC(Rpa1,5258) UNIGene(Mm.180734) |
MGI(1915525) KEGG GENES(mmu:68275) EST Profile(mm.180734) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-Inverse PCR |
Accession | AB698511 | GSS Location | chr11:75,161,854-75,162,017 | Size | 200 |
Sequence | ACACGCGTTACACAGGGCATTGGACCAGCGCCCCGCCTTACGTCCGCCATCCCGCATAGGCCTTG AACCCGGCCTTGGAAAGTCACGTGTTTTGCNTGCCGCGCGGTAGCCAATGCGGTGGCTATTCGGC GTCTAGGCCCGCCCCTTCGCACCGCGTTCACGCTGGGGGCGGATCGGCACGCACAATNTTGTTGA ATTTT |
||||
Links |
UCSC Browser(chr11:75,161,854-75,162,017) IGTC() |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR. | ||||
Links |
IMSR (for Rpa1) |