ID 21-T236
Registered: 2007.07.06 Last update: 2018.06.03
| Gene Name | pluripotency associated transcript 9 | Gene Symbol | Platr9 | |||
| Chromosome | 4 | Genomic Location | chr4:34,856,990-34,858,812 |  |
||
| Synonyms | AK010767, 2410114N07Rik | |||||
| Links |
UCSC Genome Browser(chr4:34,856,990-34,858,812) NCBI Gene(73696) IGTC(Platr9,) UNIGene(Mm.296813) |
MGI(1920946) KEGG GENES(mmu:) EST Profile(mm.296813) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB331656 | GSS Location | chr4:34,858,700-34,858,730 | Size | 35 |
| Sequence | CTTGAGCTGGCTGTAATTCCACATACAAAGTTAAG | ||||
| Links |
UCSC Browser(chr4:34,858,700-34,858,730) IGTC(Ayu21-T236) |
||||
Homology Search Results
| [AK010767] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410114N07 product:unclassifiable, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Platr9) |
||||