Gene Name | potassium channel modulatory factor 1 | Gene Symbol | Kcmf1 | |||
Chromosome | 6 | Genomic Location | chr6:72,789,187-72,851,503 | ![]() |
||
Synonyms | 1700094M07Rik, clone DEBT-91, Pmcf, Debt91 | |||||
Links |
UCSC Genome Browser(chr6:72,789,187-72,851,503) NCBI Gene(74287) IGTC(Kcmf1,12456) UNIGene(Mm.29194) |
MGI(1921537) KEGG GENES(mmu:74287) EST Profile(mm.29194) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB308317 | GSS Location | chr6:72,800,188-72,800,327 | Size | 140 |
Sequence | TGAGAATAGTGCTTTCAGAGAGAAAAAAACTAATCTCTAAGTTGTTTTTGTGTGTTTGACCTTTT CATACAGTGCCGTGCTTTAGGGTATAAGCTGCTTTTCTCAGTCTCTCTTCCATTTGGATTCTGTT CATGTGAAAG |
||||
Links |
UCSC Browser(chr6:72,800,188-72,800,327) IGTC(Ayu21-T238) |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Kcmf1) |