ID 21-T24
Registered: 2006.07.02 Last update: 2018.06.03
| Gene Name | nucleoredoxin | Gene Symbol | Nxn | |||
| Chromosome | 11 | Genomic Location | chr11:76,070,000-76,215,000 |  |
||
| Synonyms | l11Jus13 | |||||
| Links |
UCSC Genome Browser(chr11:76,070,000-76,215,000) NCBI Gene(18230) IGTC(Nxn,117) UNIGene(Mm.27915) |
MGI(109331) KEGG GENES(mmu:18230) EST Profile(mm.27915) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB264303 | GSS Location | chr11:76,170,918-76,171,027 | Size | 110 |
| Sequence | AGCAAGAGACCCTGGCTCTTCTCCTGCTTCTCCTTACAGTCTTAACTATTTCCTGTCAGTGGCAA GACCGCGTTTACTGTGTGCTAAGAAATGTTATCATCTTTAAAAAG |
||||
| Links |
UCSC Browser(chr11:76,170,918-76,171,027) IGTC(Ayu21-T24) |
||||
Homology Search Results
| [BG800797] 0053-22 Mouse E14.5 retina lambda ZAP II Library Mus musculus cDNA, mRNA sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Nxn) |
||||