| Gene Name | increased sodium tolerance 1 homolog (yeast) | Gene Symbol | Ist1 | |||
| Chromosome | 8 | Genomic Location | chr8:112,194,700-112,218,000 | |||
| Synonyms | 2400003C14Rik, mKIAA0174, AW536298 | |||||
| Links |
UCSC Genome Browser(chr8:112,194,700-112,218,000) NCBI Gene(71955) IGTC(Ist1,5796) UNIGene(Mm.290036) |
MGI(1919205) KEGG GENES(mmu:71955) EST Profile(mm.290036) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB331659 | GSS Location | chr8:112,217,084-112,217,183 | Size | 100 |
| Sequence | CTTGAGTCCGCGGTGGGGAGGTCGAGGGAGTCGCCATTTTGGATGCCGAGCGGCTCCTCGGAAGT CGGCTTCTTCCGTTTTCACGTCCGGATCCCTCCAG |
||||
| Links |
UCSC Browser(chr8:112,217,084-112,217,183) IGTC(Ayu21-T250) |
||||
| [AK134464] Mus musculus 11 days embryo head cDNA, RIKEN full-length enriched library, clone:6230401G18 product:unclassifiable, full insert sequence. |
| Card ID | 1295 | ||||
| Strain Name | B6;CB-Ist1Gt(pU-21T)250Imeg | ||||
| Internal Code | Ayu21-T250 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ist1) |
||||