ID 21-T252
Registered: 2007.07.06 Last update: 2009.02.11
| Gene Name | RIKEN cDNA 9430038I01 gene | Gene Symbol | 9430038I01Rik | |||
| Chromosome | 7 | Genomic Location | chr7:144,565,000-144,606,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr7:144,565,000-144,606,000) NCBI Gene(77252) IGTC(9430038I01Rik,23423) UNIGene(Mm.29184) |
MGI(1924502) KEGG GENES(mmu:77252) EST Profile(mm.29184) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W888 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB331660 | GSS Location | chr7:144,602,323-144,602,406 | Size | 84 |
| Sequence | GGTACGTGAAGCCGCATGGACAGCCTGGCGTCGGGCCGCTGGAGACGGCGGAGGACGGAGGAGCT GCCAGCGGCGGGGGACGCG |
||||
| Links |
UCSC Browser(chr7:144,602,323-144,602,406) IGTC(Ayu21-T252) |
||||
Homology Search Results
| [AK078159] Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330584I18 product:RIKEN cDNA 9430038I01 gene, full insert sequence. |
Mouse Information
| Card ID | 1068 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for 9430038I01Rik) |
||||