ID 21-T253
Registered: 2007.07.06 Last update: 2018.06.03
| Gene Name | mutY DNA glycosylase | Gene Symbol | Mutyh | |||
| Chromosome | 4 | Genomic Location | chr4:116,480,200-116,492,500 |  |
||
| Synonyms | 5730495A01Rik, Mutyha, Mutyhalpha, Mutyhb, Mutyhbeta, Mutyhc, Myh | |||||
| Links |
UCSC Genome Browser(chr4:116,480,200-116,492,500) NCBI Gene(70603) IGTC(Mutyh,23556) UNIGene(Mm.180333) |
MGI(1917853) KEGG GENES(mmu:70603) EST Profile(mm.180333) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB331661 | GSS Location | chr4:116,480,326-116,480,376 | Size | 50 |
| Sequence | ACGCCCCCTTCGGGGTTTCTGGGAGCGGCCGGTCGGAGACTGCGCAGGAG | ||||
| Links |
UCSC Browser(chr4:116,480,326-116,480,376) IGTC(Ayu21-T253) |
||||
Homology Search Results
| [CX213088] LOCUS CX213088, dbEST Id: 26834952, EST name: MNS17164, GenBank Acc: CX213088, GenBank gi: 56868380 |
| [AK077546] Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730444C03 product:similar to ADENINE-DNA GLYCOSYLASE [Mus musculus], full insert sequence. |
Mouse Information
| Card ID | 1113 | ||||
| Strain Name | B6;CB-MutyhGt(pU-21T)253Imeg | ||||
| Internal Code | Ayu21-T253 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.. | ||||
| Links |
IMSR (for Mutyh) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |