ID 21-T254
Registered: 2007.07.06 Last update: 2009.02.11
| Gene Name | RNA (guanine-7-) methyltransferase | Gene Symbol | Rnmt | |||
| Chromosome | 18 | Genomic Location | chr18:68,459,500-68,484,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr18:68,459,500-68,484,000) NCBI Gene(67897) IGTC(Rnmt,4525) UNIGene(Mm.27544) |
MGI(1915147) KEGG GENES(mmu:67897) EST Profile(mm.27544) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB221662 | GSS Location | chr18:68,460,043-68,460,079 | Size | 38 |
| Sequence | GGGCGTTTCCGCAAACAGAATCGTGGATGACTGTGTGG | ||||
| Links |
UCSC Browser(chr18:68,460,043-68,460,079) IGTC(Ayu21-T254) |
||||
Homology Search Results
| [AK082331] Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230038I12 product:MRNA (GUANINE-7-)METHYLTRANSFERASE (FRAGMENT) homolog [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | 1076 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rnmt) |
||||