| Gene Name | 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 | Gene Symbol | Hmgcs1 | |||
| Chromosome | 13 | Genomic Location | chr13_random:113,500-133,000 | |||
| Synonyms | B130032C06Rik | |||||
| Links |
UCSC Genome Browser(chr13_random:113,500-133,000) NCBI Gene(208715) IGTC(Hmgcs1,) UNIGene(Mm.61526) |
MGI(107592) KEGG GENES(mmu:208715) EST Profile(mm.61526) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB331663 | GSS Location | chr13_random:127,740-132,323 | Size | 110 |
| Sequence | GGCGGTCTCCTTGCTTTGCTCGTTCTTCTTCCAGGGTCTGATCCCCTTTGGTGGCTGAAGGAGGA ACCGGTGACCGACCTGGAGACCACAGTTCTCTGTCCTTCACACAG |
||||
| Links |
UCSC Browser(chr13_random:127,740-132,323) IGTC(Ayu21-T255) |
||||
| [AK031297] Mus musculus 13 days embryo male testis cDNA, RIKEN full-length enriched library, clone:6030403N11 product:pre B-cell leukemia transcription factor 1, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Hmgcs1) |
||||