ID 21-T256
Registered: 2007.07.06 Last update: 2018.06.05
| Gene Name | CUGBP, Elav-like family member 1 | Gene Symbol | Celf1 | |||
| Chromosome | 2 | Genomic Location | chr2:90,775,000-90,860,000 |  |
||
| Synonyms | 1600010O03Rik, Brunol2, CUG-BP, Cugbp1, CUG-BP1, D2Wsu101e, CUGBP, NAB50, HNAB50, AA407467 | |||||
| Links |
UCSC Genome Browser(chr2:90,775,000-90,860,000) NCBI Gene(13046) IGTC(Celf1,1727) UNIGene(Mm.29495) |
MGI(1342295) KEGG GENES(mmu:13046) EST Profile(mm.29495) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB331664 | GSS Location | chr2:90,780,713-90,780,798 | Size | 86 |
| Sequence | GGATTCGGCCTCAGCAGCGAGGCAGCGGCGGCTGCGGAGGAGCAAGGCAGCAGCTGAGGCAGCGG CGGGCTCAGGTGCAGCCGCTG |
||||
| Links |
UCSC Browser(chr2:90,780,713-90,780,798) IGTC(Ayu21-T256) |
||||
Homology Search Results
| [AK156725] Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830044E18 product:CUG triplet repeat, RNA binding protein 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Celf1) |
||||