Gene Name | receptor accessory protein 3 | Gene Symbol | Reep3 | |||
Chromosome | 10 | Genomic Location | chr10:66,473,000-66,560,100 | ![]() |
||
Synonyms | D10Ucla1 | |||||
Links |
UCSC Genome Browser(chr10:66,473,000-66,560,100) NCBI Gene(28193) IGTC(Reep3,10019) UNIGene(Mm.41272) |
MGI(88930) KEGG GENES(mmu:28193) EST Profile(mm.41272) |
Other Clone Trapped This Gene |
---|
21-B135 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB281184 | GSS Location | chr10:66,559,538-66,559,596 | Size | 59 |
Sequence | GCGGTCAGCGGCCCATCGGCCGAAAAGATGGTGTCCTGGATGATCTCCCGAGCCGTGGT | ||||
Links |
UCSC Browser(chr10:66,559,538-66,559,596) IGTC(Ayu21-T26) |
[NM_178606] Mus musculus DNA segment, Chr 10, University of California at Los Angeles 1 (D10Ucla1), mRNA. |
Card ID | 838 | ||||
Strain Name | B6;CB-Reep3Gt(pU-21T)26Imeg | ||||
Internal Code | Ayu21-T26 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Reep3) |