ID 21-T26
Registered: 2006.11.03 Last update: 2011.02.06
| Gene Name | receptor accessory protein 3 | Gene Symbol | Reep3 | |||
| Chromosome | 10 | Genomic Location | chr10:66,473,000-66,560,100 |  |
||
| Synonyms | D10Ucla1 | |||||
| Links |
UCSC Genome Browser(chr10:66,473,000-66,560,100) NCBI Gene(28193) IGTC(Reep3,10019) UNIGene(Mm.41272) |
MGI(88930) KEGG GENES(mmu:28193) EST Profile(mm.41272) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B135 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB281184 | GSS Location | chr10:66,559,538-66,559,596 | Size | 59 |
| Sequence | GCGGTCAGCGGCCCATCGGCCGAAAAGATGGTGTCCTGGATGATCTCCCGAGCCGTGGT | ||||
| Links |
UCSC Browser(chr10:66,559,538-66,559,596) IGTC(Ayu21-T26) |
||||
Homology Search Results
| [NM_178606] Mus musculus DNA segment, Chr 10, University of California at Los Angeles 1 (D10Ucla1), mRNA. |
Mouse Information
| Card ID | 838 | ||||
| Strain Name | B6;CB-Reep3Gt(pU-21T)26Imeg | ||||
| Internal Code | Ayu21-T26 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Reep3) |
||||