ID 21-T262
Registered: 2007.07.25 Last update: 2007.07.26
| Gene Name | metastasis associated 1 | Gene Symbol | Mta1 | |||
| Chromosome | 12 | Genomic Location | chr12:114,335,000-114,378,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr12:114,335,000-114,378,000) NCBI Gene(116870) IGTC(Mta1,15338) UNIGene(Mm.212577) |
MGI(2150037) KEGG GENES(mmu:116870) EST Profile(mm.212577) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB353070 | GSS Location | chr12:114,336,517-114,336,656 | Size | 140 |
| Sequence | GTCCCTTTAAACCGCCCGCCGGCGCCCCCGCGCCCGCCCCCGCCCCGGCCCGCGCCCGGCCCGCC GCCCGCGCTCGCGCCCCGCGCCCCGCGGCCCCGCCGCCGGCCCGGACATGGCCGCCAACATGTAC AGGGTCGGAG |
||||
| Links |
UCSC Browser(chr12:114,336,517-114,336,656) IGTC(Ayu21-T262) |
||||
Homology Search Results
| [BC112910] Mus musculus metastasis associated 1, mRNA (cDNA clone MGC:118456 IMAGE:6515946), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Mta1) |
||||