ID 21-T266
Registered: 2007.07.13 Last update: 2018.06.05
| Gene Name | TEA domain family member 1 | Gene Symbol | Tead1 | |||
| Chromosome | 7 | Genomic Location | chr7:119,815,729-120,054,976 |  |
||
| Synonyms | mTEF-1, TEF-1, TEAD-1, Gtrgeo5, Tcf13 | |||||
| Links |
UCSC Genome Browser(chr7:119,815,729-120,054,976) NCBI Gene(21676) IGTC(Tead1,523) UNIGene(Mm.24685) |
MGI(101876) KEGG GENES(mmu:21676) EST Profile(mm.24685) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332316 | GSS Location | chr7:119,823,138-119,823,238 | Size | 102 |
| Sequence | GGGGCTGCCCGGCGCGGGAGTACCGCAGGGAGTACCGGCTGGAGAAACGCGGGGGCGGCGGCCCA GCGCCCCGAAGTTTGCCGCGCCCGCTCGGGCTGCCGG |
||||
| Links |
UCSC Browser(chr7:119,823,138-119,823,238) IGTC(Ayu21-T266) |
||||
Homology Search Results
| [AK140307] Mus musculus adult male adrenal gland cDNA, RIKEN full-length enriched library, clone:B330014J05 product:TEA domain family member 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Tead1) |
||||