ID 21-T273
Registered: 2007.07.13 Last update: 2018.06.05
| Gene Name | calcium regulated heat stable protein 1 | Gene Symbol | Carhsp1 | |||
| Chromosome | 16 | Genomic Location | chr16:8,658,000-8,672,500 |  |
||
| Synonyms | 1200011K09Rik, D16Ertd465e, Crhsp-24 | |||||
| Links |
UCSC Genome Browser(chr16:8,658,000-8,672,500) NCBI Gene(52502) IGTC(Carhsp1,5473) UNIGene(Mm.142095) |
MGI(1196368) KEGG GENES(mmu:52502) EST Profile(mm.142095) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332317 | GSS Location | chr16:8,672,206-8,672,246 | Size | 41 |
| Sequence | AGTCGGAGAGCAGCAGCTGGAGGAGTAGGACGTGTCGCCTG | ||||
| Links |
UCSC Browser(chr16:8,672,206-8,672,246) IGTC(Ayu21-T273) |
||||
Homology Search Results
| [AK149875] Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:G530024M18 product:calcium regulated heat stable protein 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Carhsp1) |
||||