ID 21-T276
Registered: 2007.07.13 Last update: 2007.07.17
| Gene Name | thioredoxin reductase 1 | Gene Symbol | Txnrd1 | |||
| Chromosome | 10 | Genomic Location | chr10:82,295,000-82,362,000 |  |
||
| Synonyms | TR1, TrxR1, TR alpha, TR | |||||
| Links |
UCSC Genome Browser(chr10:82,295,000-82,362,000) NCBI Gene(50493) IGTC(Txnrd1,6894) UNIGene(Mm.210155) |
MGI(1354175) KEGG GENES(mmu:50493) EST Profile(mm.210155) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW67 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332318 | GSS Location | chr10:82,321,951-82,322,045 | Size | 95 |
| Sequence | AGTTTGCTTCCGTCAGGCCTCGCGTCCACGCGGGAGGTGCGGGACACTGACACCGCGGGGCGAGT AGAGCTGGTGGTTTCACCTTCCTTGTTCAT |
||||
| Links |
UCSC Browser(chr10:82,321,951-82,322,045) IGTC(Ayu21-T276) |
||||
Homology Search Results
| [AK146125] Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched library, clone:I730007C19 product:thioredoxin reductase 1, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Txnrd1) |
||||