ID 21-T277
Registered: 2007.06.15 Last update: 2018.06.05
| Gene Name | TEN1 telomerase capping complex subunit | Gene Symbol | Ten1 | |||
| Chromosome | 11 | Genomic Location | chr11:116,059,400-116,076,869 |  |
||
| Synonyms | 2310004N24Rik, RP23-174D24.1 | |||||
| Links |
UCSC Genome Browser(chr11:116,059,400-116,076,869) NCBI Gene(69535) IGTC(Ten1,23510) UNIGene(Mm.390347) |
MGI(1916785) KEGG GENES(mmu:69535) EST Profile(mm.390347) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB326234 | GSS Location | chr11:116,060,184-116,060,297 | Size | 114 |
| Sequence | ACTCCTCACGTGACCGGCTGCAATCCCCGACGCTGGTACCGCCCGCCGGACGGACGAATCCCTTG CTGCGGGCCAGGGGAGGTCCCCGAGCGGCTCCTCGCCAAGGAAAGCAAG |
||||
| Links |
UCSC Browser(chr11:116,060,184-116,060,297) IGTC(Ayu21-T277) |
||||
Homology Search Results
| [BC027639] Mus musculus RIKEN cDNA 2310004N24 gene, mRNA (cDNA clone MGC:41326 IMAGE:1069092), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ten1) |
||||