ID 21-T278

Registered: 2007.07.13   Last update: 2023.09.10
Gene Name transmembrane protein 161A Gene Symbol Tmem161a
Chromosome 8 Genomic Location chr8:72,695,500-72,708,000
Synonyms MGC:29210, AI428876, BB161850, BC021367
Links UCSC Genome Browser(chr8:72,695,500-72,708,000)
NCBI Gene(234371)
IGTC(Tmem161a,23714)
UNIGene(Mm.23488)
 MGI(2384577)
KEGG GENES(mmu:234371)
EST Profile(mm.23488)
Other Clone Trapped This Gene
Trap Vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB332319 GSS Location chr8:72,696,307-72,696,339 Size 34
Sequence GCTCGTACCGCTGTGCGCCCAGGGAGCGGACATG
Links UCSC Browser(chr8:72,696,307-72,696,339)
IGTC(Ayu21-T278)

Homology Search Results

[AK032711] Mus musculus 12 days embryo male wolffian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6720407I22 product:SIMILAR TO HYPOTHETICAL PROTEIN FLJ20422 homolog [Mus musculus], full insert sequence.

Mouse Information

Card ID 1069
Strain Name B6;CB-Tmem161aGt(pU-21T)278Imeg
Internal Code Ayu21-T278
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
[Paper] "Tmem161a regulates bone formation and bone strength through the P38 MAPK pathway."Takuya Nagai, Tomohisa Sekimoto, Syuji Kurogi, Tomomi Ohta, Shihoko Miyazaki, Yoichiro Yamaguchi, Takuya Tajima, Etsuo Chosa, Mai Imasaka, Kumiko Yoshinobu, Kimi Araki, Masatake Araki, Narantsog Choijookhuu, Katsuaki Sato, Yoshitaka Hishikawa, Taro Funamoto, Sci. Rep., 13(1), 14639 (2023). DOI: 10.1038/s41598-023-41837-4. PubMed ID:37670024.
Links IMSR (for Tmem161a)