ID 21-T279
Registered: 2007.06.28 Last update: 2007.06.29
| Gene Name | zinc finger, DHHC domain containing 18 | Gene Symbol | Zdhhc18 | |||
| Chromosome | 4 | Genomic Location | chr4:133,162,000-133,190,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr4:133,162,000-133,190,000) NCBI Gene(503610) IGTC(Zdhhc18,6719) UNIGene(Mm.331948) |
MGI(3527792) KEGG GENES(mmu:503610) EST Profile(mm.331948) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T548 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330748 | GSS Location | chr4:133,188,994-133,189,129 | Size | 136 |
| Sequence | GGCGTAAGTGGGAGGTGTTCCCGGGCCGCAACCGCTTCTACTGCGGAGGCCGGCTCATGCTGGCC GGCCACGGGGGNGTTTTCGCGCTCACGCTGCTGCTCATCCTCAGCACCGCCATCCTCTTCTTCGT CTTCGA |
||||
| Links |
UCSC Browser(chr4:133,188,994-133,189,129) IGTC(Ayu21-T279) |
||||
Homology Search Results
| [CJ049628] dbEST Id: 31759838, EST name: CJ049628, GenBank Acc: CJ049628, GenBank gi: 75991198 |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Zdhhc18) |
||||