| Gene Name | CDC42 small effector 2 | Gene Symbol | Cdc42se2 | |||
| Chromosome | 11 | Genomic Location | chr11:54,526,000-54,610,000 | |||
| Synonyms | 2810404F18Rik, SPEC2, AA408783, AA536669 | |||||
| Links |
UCSC Genome Browser(chr11:54,526,000-54,610,000) NCBI Gene(72729) IGTC(Cdc42se2,4454) UNIGene(Mm.29476) |
MGI(1919979) KEGG GENES(mmu:72729) EST Profile(mm.29476) |
||||
| Other Clone Trapped This Gene |
|---|
| 22-79 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB326236 | GSS Location | chr11:54,569,908-54,601,179 | Size | 273 |
| Sequence | CGGGAGGGCGGAGCCCGAAGCGGGGAGCGCAGCTGCTTGGTGTGTGGAGATCCTGGAAGCTTCGG AGCCGGCGCTCGGAGCCGCGCGGCTGGAGCAGGCGGCGGAGACAAAGGCGACGATAGGGCCAGTG TTGAGTGAAACAAACGCAGAAACCAAAAGAGAAGACGTCTTCAAGGAACAACTTATGCTAATGAG TCTGAAGAGTCTCCTGTGTGTGTCTTTCAAGCATAGTCTCCATTCAGAGAGCTGAGTGAGTGGCC ACATTGATGAGTG |
||||
| Links |
UCSC Browser(chr11:54,569,908-54,601,179) IGTC(Ayu21-T280) |
||||
| [AK160934] Mus musculus 13 days embryo whole body cDNA, RIKEN full-length enriched library, clone:3930402J06 product:Non-kinase Cdc42 effector protein SPEC2 homolog [Homo sapiens], full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Cdc42se2) |
||||