ID 21-T281
Registered: 2007.06.15 Last update: 2007.06.19
| Gene Name | GLI-Kruppel family member GLI2 | Gene Symbol | Gli2 | |||
| Chromosome | 1 | Genomic Location | chr1:120,725,000-120,960,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr1:120,725,000-120,960,000) NCBI Gene(14633) IGTC(Gli2,1691) UNIGene(Mm.273292) |
MGI(95728) KEGG GENES(mmu:14633) EST Profile(mm.273292) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBW156 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB326237 | GSS Location | chr1:120,949,879-120,949,995 | Size | 117 |
| Sequence | AGCCGGAGCCCCCGCACTCGGCAGCCCCACTCCAGCCAAGTTGGGATGGGGCCCTGCAACCACTG CCCGGCGCCCGAGAGGCCACCTGCATGCTAGAGGCAAACTTTTGTCTCCTCG |
||||
| Links |
UCSC Browser(chr1:120,949,879-120,949,995) IGTC(Ayu21-T281) |
||||
Homology Search Results
| [BC085190] Mus musculus GLI-Kruppel family member GLI2, mRNA (cDNA clone MGC:115753 IMAGE:30694633), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Gli2) |
||||