Gene Name | GLI-Kruppel family member GLI2 | Gene Symbol | Gli2 | |||
Chromosome | 1 | Genomic Location | chr1:120,725,000-120,960,000 | ![]() |
||
Synonyms | ||||||
Links |
UCSC Genome Browser(chr1:120,725,000-120,960,000) NCBI Gene(14633) IGTC(Gli2,1691) UNIGene(Mm.273292) |
MGI(95728) KEGG GENES(mmu:14633) EST Profile(mm.273292) |
Other Clone Trapped This Gene |
---|
21-KBW156 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB326237 | GSS Location | chr1:120,949,879-120,949,995 | Size | 117 |
Sequence | AGCCGGAGCCCCCGCACTCGGCAGCCCCACTCCAGCCAAGTTGGGATGGGGCCCTGCAACCACTG CCCGGCGCCCGAGAGGCCACCTGCATGCTAGAGGCAAACTTTTGTCTCCTCG |
||||
Links |
UCSC Browser(chr1:120,949,879-120,949,995) IGTC(Ayu21-T281) |
[BC085190] Mus musculus GLI-Kruppel family member GLI2, mRNA (cDNA clone MGC:115753 IMAGE:30694633), complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Gli2) |