Gene Name | sideroflexin 1 | Gene Symbol | Sfxn1 | |||
Chromosome | 13 | Genomic Location | chr13:54,165,000-54,205,000 | ![]() |
||
Synonyms | 2810002O05Rik, A930015P12Rik | |||||
Links |
UCSC Genome Browser(chr13:54,165,000-54,205,000) NCBI Gene(14057) IGTC(Sfxn1,13664) UNIGene(Mm.134191) |
MGI(2137677) KEGG GENES(mmu:14057) EST Profile(mm.134191) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB330875 | GSS Location | chr13:54,167,247-54,167,301 | Size | 55 |
Sequence | AGCTGGAGGCGGCGCCGAACGGGACCGAGCGGCGCGGGTGGCGGCCGGGTAGGCG | ||||
Links |
UCSC Browser(chr13:54,167,247-54,167,301) IGTC(Ayu21-T287) |
[AF325260] Mus musculus sideroflexin 1 (Sfxn1) mRNA, complete cds; nuclear gene for mitochondrial product. |
Card ID | 1083 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Sfxn1) |
Description | X-gal staining was performed for detecting β-galactocidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |