ID 21-T287
Registered: 2007.06.29 Last update: 2018.06.08
| Gene Name | sideroflexin 1 | Gene Symbol | Sfxn1 | |||
| Chromosome | 13 | Genomic Location | chr13:54,165,000-54,205,000 |  |
||
| Synonyms | 2810002O05Rik, A930015P12Rik | |||||
| Links |
UCSC Genome Browser(chr13:54,165,000-54,205,000) NCBI Gene(14057) IGTC(Sfxn1,13664) UNIGene(Mm.134191) |
MGI(2137677) KEGG GENES(mmu:14057) EST Profile(mm.134191) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330875 | GSS Location | chr13:54,167,247-54,167,301 | Size | 55 |
| Sequence | AGCTGGAGGCGGCGCCGAACGGGACCGAGCGGCGCGGGTGGCGGCCGGGTAGGCG | ||||
| Links |
UCSC Browser(chr13:54,167,247-54,167,301) IGTC(Ayu21-T287) |
||||
Homology Search Results
| [AF325260] Mus musculus sideroflexin 1 (Sfxn1) mRNA, complete cds; nuclear gene for mitochondrial product. |
Mouse Information
| Card ID | 1083 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sfxn1) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactocidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |