ID 21-T29
Registered: 2006.07.10 Last update: 2015.08.17
| Gene Name | zinc finger protein 80 | Gene Symbol | Zfp808 | |||
| Chromosome | 13 | Genomic Location | chr13:62,230,500-62,276,000 |  |
||
| Synonyms | Gm7036, EG630579, MGC74346 | |||||
| Links |
UCSC Genome Browser(chr13:62,230,500-62,276,000) NCBI Gene(630579) IGTC(Zfp808,13120) UNIGene(Mm.440905) |
MGI(3704127) KEGG GENES(mmu:630579) EST Profile(mm.440905) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB265216 | GSS Location | chr13:62,231,281-62,231,386 | Size | 111 |
| Sequence | CTGGCTCTGTTACTCTCCGTTGCGAGCAAGCTGAAAGATTGGTCTGATGTGTTTTGATCTCTGCT GCCAGGGACCCTAGGGCAATGCCAGCGATCTACAAGGTGGCGACAG |
||||
| Links |
UCSC Browser(chr13:62,231,281-62,231,386) IGTC(Ayu21-T29) |
||||
Homology Search Results
| [BC061203] Mus musculus similar to zinc finger protein 124, mRNA (cDNA clone MGC:74346 IMAGE:30248220), complete cds. |
| [AK013043] Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2810408B13 product:weakly similar to KRUPPEL-RELATED ZINC FINGER PROTEIN F80-M (HYPOTHETICAL 48.8 KDA PROTEIN) [Mus musculus], full insert sequence. |
Mouse Information
| Card ID | 830 | ||||
| Strain Name | B6-Zfp808Gt(pU-21T)29Imeg | ||||
| Internal Code | Ayu21-T29 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Zfp808) |
||||