ID 21-T290
Registered: 2007.06.16 Last update: 2018.06.08
| Gene Name | vesicle-associated membrane protein, associated protein B and C | Gene Symbol | Vapb | |||
| Chromosome | 2 | Genomic Location | chr2:173,561,000-173,610,000 |  |
||
| Synonyms | R75548; VAP33b; D2Abb2e; Vamp33b; AI225786; AI840687; AI848259 | |||||
| Links |
UCSC Genome Browser(chr2:173,561,000-173,610,000) NCBI Gene(56491) IGTC(Vapb,2509) UNIGene(Mm.260456) |
MGI(1928744) KEGG GENES(mmu:56491) EST Profile(mm.260456) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB326240 | GSS Location | chr2:173,563,156-173,563,251 | Size | 96 |
| Sequence | GCCCCCCGCCCGCGCCGTCGCCCCCGACGGGGAGGACCATGGCGAAGGTGGAACAGGTCCTGAGC CTCGAGCCACAACACGAGCTCAAGTTCCGAG |
||||
| Links |
UCSC Browser(chr2:173,563,156-173,563,251) IGTC(Ayu21-T290) |
||||
Homology Search Results
| [BC048231] Mus musculus vesicle-associated membrane protein, associated protein B and C, mRNA (cDNA clone MGC:54551 IMAGE:6313869), complete cds. |
Mouse Information
| Card ID | 1106 | ||||
| Strain Name | B6;CB-VapbGt(pU-21T)290Imeg | ||||
| Internal Code | Ayu21-T290 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA).Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Vapb) |
||||