| Gene Name | ribosomal protein L23 | Gene Symbol | Rpl23 | |||
| Chromosome | 11 | Genomic Location | chr11:97,638,800-97,644,000 | |||
| Synonyms | Rpl23l, L23mrp, 2810009A01Rik | |||||
| Links |
UCSC Genome Browser(chr11:97,638,800-97,644,000) NCBI Gene(65019) IGTC(Rpl23,33817) UNIGene(Mm.140380) |
MGI(1929455) KEGG GENES(mmu:65019) EST Profile(mm.140380) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332320 | GSS Location | chr11:97,643,120-97,643,698 | Size | 125 |
| Sequence | CTTTTCTGTCCCTTTCCGGGCGTTCAAGACGTCGAAGCGAGGACGCGGTGGGTCCTCCGGGGCGA AATTCCGGATTTCCCTGGGTCTTCCGGTCGGAGCTGTGATCAACTGTGCAGACAACACAG |
||||
| Links |
UCSC Browser(chr11:97,643,120-97,643,698) IGTC(Ayu21-T296) |
||||
| [AK150671] Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830013H08 product:ribosomal protein L23, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rpl23) |
||||