ID 21-T297
Registered: 2007.06.28 Last update: 2018.06.08
| Gene Name | MAP/microtubule affinity-regulating kinase 3 | Gene Symbol | Mark3 | |||
| Chromosome | 12 | Genomic Location | chr12:112,810,000-112,895,500 |  |
||
| Synonyms | 1600015G02Rik, A430080F22Rik, C-TAK1, ETK-1, mKIAA1860, ETK1, Emk2, MPK10 | |||||
| Links |
UCSC Genome Browser(chr12:112,810,000-112,895,500) NCBI Gene(17169) IGTC(Mark3,2585) UNIGene(Mm.420865) |
MGI(1341865) KEGG GENES(mmu:17169) EST Profile(mm.420865) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W330 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330742 | GSS Location | chr12:112,813,186-112,813,312 | Size | 127 |
| Sequence | CCGCTGCTCGCCGGCCGCCCAAAGCTGGGCGGTTTTGTTTTCGCCTTGGCGTTGTGCGGAATCAA AGCGCAATAAGATGTCCACTAGGACCCCTTTGCCAACGGTGAATGAACGAGACACTGAAAAC |
||||
| Links |
UCSC Browser(chr12:112,813,186-112,813,312) IGTC(Ayu21-T297) |
||||
Homology Search Results
| [AF240782] Mus musculus ELKL motif kinase 2 long form (EMK2) mRNA, complete cds. |
Mouse Information
| Card ID | 1077 | ||||
| Strain Name | B6;CB-Mark3Gt(pU-21T)297Imeg | ||||
| Internal Code | Ayu21-T297 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071. |
||||
| Links |
IMSR (for Mark3) |
||||