Gene Name | Cysteine-serine-rich nuclear protein 3 | Gene Symbol | Csrnp3 | |||
Chromosome | 2 | Genomic Location | chr2:65,665,000-65,872,300 | ![]() |
||
Synonyms | Mbu1, Csnrp3, taip-2, CSRNP-3, A330102K23Rik, mbu1 | |||||
Links |
UCSC Genome Browser(chr2:65,665,000-65,872,300) NCBI Gene(77771) IGTC(Csrnp3,15334) UNIGene(Mm.102025) |
MGI(1925021) KEGG GENES(mmu:77771) EST Profile(mm.102025) |
Other Clone Trapped This Gene |
---|
21-W304 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB363941 | GSS Location | chr2:65,683,899-65,683,941 | Size | 43 |
Sequence | AGTGTGTTCTGCTGGAGCCCAAGTACAGAGACCATATTTACAG | ||||
Links |
UCSC Browser(chr2:65,683,899-65,683,941) IGTC(Ayu21-T300) |
[EF210820] Mus musculus MBU1 (Mbu1) mRNA, complete cds. |
Card ID | 1100 | ||||
Strain Name | B6;CB-Csrnp3Gt(pU-21T)300Imeg | ||||
Internal Code | Ayu21-T300 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Csrnp3) |