| Gene Name | DnaJ heat shock protein family (Hsp40) member C5 | Gene Symbol | Dnajc5 | |||
| Chromosome | 2 | Genomic Location | chr2:181,255,000-181,288,000 | |||
| Synonyms | 610314I24Rik, Csp, AU018536 | |||||
| Links |
UCSC Genome Browser(chr2:181,255,000-181,288,000) NCBI Gene(13002) IGTC(Dnajc5,2717) UNIGene(Mm.140761) |
MGI(892995) KEGG GENES(mmu:13002) EST Profile(mm.140761) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354918 | GSS Location | chr2:181,255,289-181,255,402 | Size | 114 |
| Sequence | GTCTGTCGCCGCCCGGGATCCTCAGGCCGAGCAGTAGGCCGGCCGGCTGCCCACCACTGCCCCGG GACGGAAAGCGGAGCCGCGGAACCGGTGGACCGGCGGGCGTGCCGACAG |
||||
| Links |
UCSC Browser(chr2:181,255,289-181,255,402) IGTC(Ayu21-T309) |
||||
| [AK083584] Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030049H18 product:DnaJ (Hsp40) homolog, subfamily C, member 5, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Dnajc5) |
||||