ID 21-T314
Registered: 2007.08.10 Last update: 2018.06.08
| Gene Name | RNA binding motif protein, X-linked like-1 | Gene Symbol | Rbmxl1 | |||
| Chromosome | 8 | Genomic Location | chr8:81,029,000-81,033,000 |  |
||
| Synonyms | hnRNP G, Hnrpg, Rbmxrt, Rbmx | |||||
| Links |
UCSC Genome Browser(chr8:81,029,000-81,033,000) NCBI Gene(19656) IGTC(Rbmxl1,6826) UNIGene(Mm.24718) |
MGI(1343045) KEGG GENES(mmu:19656) EST Profile(mm.24718) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354919 | GSS Location | chr8:81,032,698-81,032,798 | Size | 102 |
| Sequence | ATTCGCGGCCTCTGGTTCTCGGCGGGAGCGGCGGCGGCAAGACGCGTGTGGCGACCGGCGCGGGA AAGCGGCTTCCTAGTTAGGGAAGCGTTAGCCCCGTGG |
||||
| Links |
UCSC Browser(chr8:81,032,698-81,032,798) IGTC(Ayu21-T314) |
||||
Homology Search Results
| [AK149658] Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:G530008F02 product:RNA binding motif protein, X chromosome retrogene, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rbmxl1) |
||||