ID 21-T315
Registered: 2007.07.15 Last update: 2018.06.08
| Gene Name | solute carrier family 25, member 51 | Gene Symbol | Slc25a51 | |||
| Chromosome | 4 | Genomic Location | chr4:45,408,500-45,422,500 |  |
||
| Synonyms | Gm138, Mcart1, 9130208E07Rik, D130005A03Rik | |||||
| Links |
UCSC Genome Browser(chr4:45,408,500-45,422,500) NCBI Gene(230125) IGTC(Slc25a51,14928) UNIGene(Mm.260210) |
MGI(2684984) KEGG GENES(mmu:230125) EST Profile(mm.260210) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332410 | GSS Location | chr4:45,421,567-45,421,599 | Size | 33 |
| Sequence | AGCCGTCCTGCGGGCTTGCGCCCCGGGCCGTGG | ||||
| Links |
UCSC Browser(chr4:45,421,567-45,421,599) IGTC(Ayu21-T315) |
||||
Homology Search Results
| [AK146788] Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920055M12 product:Mitochondrial carrier triple repeat 1 homolog [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | 2263 | ||||
| Strain Name | B6.Cg-Slc25a51Gt(pU-21T)315Card | ||||
| Internal Code | Ayu21-T315 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Slc25a51) |
||||