Gene Name | solute carrier family 25, member 51 | Gene Symbol | Slc25a51 | |||
Chromosome | 4 | Genomic Location | chr4:45,408,500-45,422,500 | ![]() |
||
Synonyms | Gm138, Mcart1, 9130208E07Rik, D130005A03Rik | |||||
Links |
UCSC Genome Browser(chr4:45,408,500-45,422,500) NCBI Gene(230125) IGTC(Slc25a51,14928) UNIGene(Mm.260210) |
MGI(2684984) KEGG GENES(mmu:230125) EST Profile(mm.260210) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB332410 | GSS Location | chr4:45,421,567-45,421,599 | Size | 33 |
Sequence | AGCCGTCCTGCGGGCTTGCGCCCCGGGCCGTGG | ||||
Links |
UCSC Browser(chr4:45,421,567-45,421,599) IGTC(Ayu21-T315) |
[AK146788] Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920055M12 product:Mitochondrial carrier triple repeat 1 homolog [Homo sapiens], full insert sequence. |
Card ID | 2263 | ||||
Strain Name | B6.Cg-Slc25a51Gt(pU-21T)315Card | ||||
Internal Code | Ayu21-T315 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Slc25a51) |