ID 21-T318
Registered: 2007.08.13 Last update: 2018.06.08
| Gene Name | RAB10, member RAS oncogene family, opposite strand | Gene Symbol | Rab10os | |||
| Chromosome | 12 | Genomic Location | chr12:3,235,000-3,251,000 |  |
||
| Synonyms | 1700012B15Rik, 1810036A22Rik | |||||
| Links |
UCSC Genome Browser(chr12:3,235,000-3,251,000) NCBI Gene(74173) IGTC(Rab10os,16810) UNIGene(Mm.309774) |
MGI(1921423) KEGG GENES(mmu:) EST Profile(mm.309774) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354928 | GSS Location | chr12:3,237,361-3,238,108 | Size | 202 |
| Sequence | GATCCTGGAGAAGTCAAAGGACCAGGAGGACGCCATGGGGGGTGCTGTACAGGCTGAGCAGGAAG CAGAGCAGCACAGCGTCATCATGAGGGTAGCCATCTTCACCTGGGGCATCCACGGAGGCCCTGCC CAGGAAGTGACTTTCTCTCTACTGTAGGAGGAGCTGATCCACGACTACTTGGACAACAGCACACC AGCGAAG |
||||
| Links |
UCSC Browser(chr12:3,237,361-3,238,108) IGTC(Ayu21-T318) |
||||
Homology Search Results
| [AK005738] Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700007N07 product:hypothetical protein, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rab10os) |
||||