Gene Name | aminolevulinate, delta-, dehydratase | Gene Symbol | Alad | |||
Chromosome | 4 | Genomic Location | chr4:62,169,900-62,181,800 | ![]() |
||
Synonyms | Lv, ALADH | |||||
Links |
UCSC Genome Browser(chr4:62,169,900-62,181,800) NCBI Gene(17025) IGTC(Alad,24520) UNIGene(Mm.6988) |
MGI(96853) KEGG GENES(mmu:17025) EST Profile(mm.6988) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB354919 | GSS Location | chr4:62,180,894-62,180,948 | Size | 55 |
Sequence | CGGGAGAGCGCGGTGTCCAGAGCCCGGCTCGGAGCGGCGGCGAGCAGCGTCCTTG | ||||
Links |
UCSC Browser(chr4:62,180,894-62,180,948) IGTC(Ayu21-T323) |
[AK168119] Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730058L01 product:aminolevulinate, delta-, dehydratase, full insert sequence. |
Card ID | 1085 | ||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Alad) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |