ID 21-T323
Registered: 2007.08.13 Last update: 2018.06.11
| Gene Name | aminolevulinate, delta-, dehydratase | Gene Symbol | Alad | |||
| Chromosome | 4 | Genomic Location | chr4:62,169,900-62,181,800 |  |
||
| Synonyms | Lv, ALADH | |||||
| Links |
UCSC Genome Browser(chr4:62,169,900-62,181,800) NCBI Gene(17025) IGTC(Alad,24520) UNIGene(Mm.6988) |
MGI(96853) KEGG GENES(mmu:17025) EST Profile(mm.6988) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354919 | GSS Location | chr4:62,180,894-62,180,948 | Size | 55 |
| Sequence | CGGGAGAGCGCGGTGTCCAGAGCCCGGCTCGGAGCGGCGGCGAGCAGCGTCCTTG | ||||
| Links |
UCSC Browser(chr4:62,180,894-62,180,948) IGTC(Ayu21-T323) |
||||
Homology Search Results
| [AK168119] Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730058L01 product:aminolevulinate, delta-, dehydratase, full insert sequence. |
Mouse Information
| Card ID | 1085 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Alad) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |