ID 21-T324
Registered: 2007.06.29 Last update: 2018.06.11
| Gene Name | predicted gene 13212 | Gene Symbol | Gm13212 | |||
| Chromosome | 4 | Genomic Location | chr4:145,173,714-145,216,658 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr4:145,173,714-145,216,658) NCBI Gene(433801) IGTC(Gm13212,31709) UNIGene(Mm.) |
MGI(3651014) KEGG GENES(mmu:433801) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330878 | GSS Location | chr4:145,175,099-145,177,418 | Size | 229 |
| Sequence | GCATCTCGGCTGCCTCGTGATCAGGAAGTTATGGAGGGAGACTAGCGCCTAGTATTTGCGGAACC TGAAAACTTTCTTAAGCAGCAGTTGTTGTGCTGGCCTCCTAGGACATTGAGCAGCTGGTCCTGTC ACCTTCCCAGATATTCATATGCTCAGCCAAATGTGCATAACTGTAAATCAACACTAAGAGCACCT GAGGTTAAGGTCAAGGAGATCTCACAAGGACCAG |
||||
| Links |
UCSC Browser(chr4:145,175,099-145,177,418) IGTC(Ayu21-T324) |
||||
Homology Search Results
| [AB201548] Mus musculus mRNA, EGTC gene trap library, clone: Ayu18-91, genomic survey sequence gi|58737162|dbj|AB201548.1|[58737162] |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Gm13212) |
||||