ID 21-T325
Registered: 2007.06.16 Last update: 2018.06.11
| Gene Name | protein kinase C and casein kinase substrate in neurons 2 | Gene Symbol | Pacsin2 | |||
| Chromosome | 15 | Genomic Location | chr15:83,205,000-83,300,000 |  |
||
| Synonyms | Syndapin II, AI197433 | |||||
| Links |
UCSC Genome Browser(chr15:83,205,000-83,300,000) NCBI Gene(23970) IGTC(Pacsin2,22343) UNIGene(Mm.23978) |
MGI(1345153) KEGG GENES(mmu:23970) EST Profile(mm.23978) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB326241 | GSS Location | chr15:83,294,889-83,294,976 | Size | 88 |
| Sequence | CTCGGTTGGAGCGGAACGGGAAGGGGTCGGAGTCGCAGCCCGGCCGGGGCGGCGTGCTCAGTGGG ACCCGAGGCGAACGGCGGCCGAG |
||||
| Links |
UCSC Browser(chr15:83,294,889-83,294,976) IGTC(Ayu21-T325) |
||||
Homology Search Results
| [CK617671] dbEST Id: 21463310, EST name: mk08b11.y2, GenBank Acc: CK617671 |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Pacsin2) |
||||