ID 21-T330
Registered: 2007.08.10 Last update: 2018.06.11
| Gene Name | lysine methyltransferase 5A | Gene Symbol | Kmt5a | |||
| Chromosome | 5 | Genomic Location | chr5:124,889,100-124,913,000 |  |
||
| Synonyms | 2410195B05Rik, PR-SET7, Setd8, AA617402, AW536475, PR/SET07 | |||||
| Links |
UCSC Genome Browser(chr5:124,889,100-124,913,000) NCBI Gene(67956) IGTC(Kmt5a,10249) UNIGene(Mm.137966) |
MGI(1915206) KEGG GENES(mmu:67956) EST Profile(mm.137966) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354921 | GSS Location | chr5:124,889,913-124,890,024 | Size | 110 |
| Sequence | CACCCGCAGCTGCGGTCTAGCTGAGCAGTTGGCTACAGTTGTTGCAACTTTTTTCGAAAGCTGGG TTTCCCGGGAGATTCCAGGCGGGACAGAGCCCGGCCAGGCTAGAG |
||||
| Links |
UCSC Browser(chr5:124,889,913-124,890,024) IGTC(Ayu21-T330) |
||||
Homology Search Results
| [AK030904] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830452G14 product:PR/SET DOMAIN-CONTAINING PROTEIN 07 homolog [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Kmt5a) |
||||