| Gene Name | ribosomal protein S13 | Gene Symbol | Rps13 | |||
| Chromosome | 7 | Genomic Location | chr7:123,474,925-123,477,765 | |||
| Synonyms | 2700063M04Rik | |||||
| Links |
UCSC Genome Browser(chr7:123,474,925-123,477,765) NCBI Gene(68052) IGTC(Rps13,9132) UNIGene(Mm.14798) |
MGI(1915302) KEGG GENES(mmu:68052) EST Profile(mm.14798) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354930 | GSS Location | chr7:123,477,210-123,477,625 | Size | 155 |
| Sequence | CATCATGGGTCGCATGCACGCTCCCGGGAAGGGCCTGTCCCAGTCGGCGCTGCCCTACCGCCGTA GCGTCCCCACGTGGCTGAAGTTGACGTCTGACGACGTGAAGGAACAGATTTACAAATTGGCCAAG AAAGGCCTGACTCCCTCCCAGATAG |
||||
| Links |
UCSC Browser(chr7:123,477,210-123,477,625) IGTC(Ayu21-T331) |
||||
| [BC125604] Mus musculus ribosomal protein S13, mRNA (cDNA clone MGC:159307 IMAGE:40130119), complete cds. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rps13) |
||||