ID 21-T332
Registered: 2007.07.13 Last update: 2018.06.11
| Gene Name | processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae) | Gene Symbol | Pop5 | |||
| Chromosome | 5 | Genomic Location | chr5:115,685,500-115,695,800 |  |
||
| Synonyms | 1500019J17Rik, 2700077E03Rik, Rnasep3, AW049989 | |||||
| Links |
UCSC Genome Browser(chr5:115,685,500-115,695,800) NCBI Gene(117109) IGTC(Pop5,22626) UNIGene(Mm.24636) |
MGI(2151221) KEGG GENES(mmu:117109) EST Profile(mm.24636) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB332321 | GSS Location | chr5:115,688,027-115,688,078 | Size | 53 |
| Sequence | GGCCGCCTTCCTCCCGCATCCGGCGCGGACGCCATGGTGCGGTTCAAGCACAG | ||||
| Links |
UCSC Browser(chr5:115,688,027-115,688,078) IGTC(Ayu21-T332) |
||||
Homology Search Results
| [BC022670] Mus musculus processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae), mRNA (cDNA clone MGC:31334 IMAGE:4224973), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Pop5) |
||||